Sequence retrieval

Genome: Conexibacter woesei DSM 14684
Start position: 1100984
End position: 1101007
Length: 24

DNA sequence
>NC_013739, from 1100984 to 1101007 (24 bp); Conexibacter woesei DSM 14684 GGAGGCGGGGGCGGCGGCGGATGC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1097343-1101620	Sequence	Cwoe_1042 - 2-oxoglutarate dehydrogenase, E1 subunit (Protein is coded in complementary strand; from 1101620 to 1097343)