Sequence retrieval

Genome: Conexibacter woesei DSM 14684
Start position: 1145437
End position: 1145493
Length: 57

DNA sequence
>NC_013739, from 1145437 to 1145493 (57 bp); Conexibacter woesei DSM 14684 CTACCCCGCGCCGGCCGCTCTACCCCGAGGTGGCCGCTCTACCCCGAGGTGGCCGCT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF... 1145476-1145841	Sequence	Cwoe_1086 - hypothetical protein (Protein is coded in complementary strand; from 1145841 to 1145476)