Sequence retrieval

Genome: Conexibacter woesei DSM 14684
Start position: 1151832
End position: 1151876
Length: 45

DNA sequence
>NC_013739, from 1151832 to 1151876 (45 bp); Conexibacter woesei DSM 14684 ACGCCGCCCGCGCCCACGCCGCCCGCGCCCACGCCGCCCGCGCCC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1151226-1152512	Sequence	Cwoe_1093 - CdaR family transcriptional regulator (Protein is coded in complementary strand; from 1152512 to 1151226)