Sequence retrieval

Genome: Conexibacter woesei DSM 14684
Start position: 1162035
End position: 1162064
Length: 30

DNA sequence
>NC_013739, from 1162035 to 1162064 (30 bp); Conexibacter woesei DSM 14684 TCGCCGTCGTCGTCGCCGCCGCCGCCGCCG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1161891-1163693	Sequence	Cwoe_1104 - penicillin-binding protein transpeptidase (Protein is coded in complementary strand; from 1163693 to 1161891)