Sequence retrieval

Genome: Conexibacter woesei DSM 14684
Start position: 1252241
End position: 1252276
Length: 36

DNA sequence
>NC_013739, from 1252241 to 1252276 (36 bp); Conexibacter woesei DSM 14684 GCCGGGTGCGCCGGGGGCGCCGGGTGCGCCGGGGGC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1252059-1253102	Sequence	Cwoe_1193 - LysR family transcriptional regulator (Protein is coded in complementary strand; from 1253102 to 1252059)