Sequence retrieval

Genome: Conexibacter woesei DSM 14684
Start position: 126381
End position: 126407
Length: 27

DNA sequence
>NC_013739, from 126381 to 126407 (27 bp); Conexibacter woesei DSM 14684 CCGGTCGCGCCCGTCGCGCCGGCCGCG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 126012-128807	Sequence	Cwoe_0127 - PKD domain-containing protein (Protein is coded in complementary strand; from 128807 to 126012)