Sequence retrieval

Genome: Conexibacter woesei DSM 14684
Start position: 1291086
End position: 1291130
Length: 45

DNA sequence
>NC_013739, from 1291086 to 1291130 (45 bp); Conexibacter woesei DSM 14684 CGACGCCGAGCGCGTCGGCGCCGAGCGCGGCGATCCCGAGCGTGT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1290488-1291321	Sequence	Cwoe_1234 - methyltransferase type 12 (Protein is coded in complementary strand; from 1291321 to 1290488)