Sequence retrieval

Genome: Conexibacter woesei DSM 14684
Start position: 1307926
End position: 1307970
Length: 45

DNA sequence
>NC_013739, from 1307926 to 1307970 (45 bp); Conexibacter woesei DSM 14684 GCCGCCTGCGTCCGCGCCGCCTGCGTCCGCGCCGCCTGCGTCCGC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1307132-1308031	Sequence	Cwoe_1248 - creatininase (Protein is coded in complementary strand; from 1308031 to 1307132)