Sequence retrieval

Genome: Conexibacter woesei DSM 14684
Start position: 1313468
End position: 1313494
Length: 27

DNA sequence
>NC_013739, from 1313468 to 1313494 (27 bp); Conexibacter woesei DSM 14684 GGTCGGCGAGGACGGCGAGGACGGCGA
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1311613-1313565	Sequence	Cwoe_1252 - oligopeptide/dipeptide ABC transporter ATPase