Sequence retrieval

Genome: Conexibacter woesei DSM 14684
Start position: 1338329
End position: 1338382
Length: 54

DNA sequence
>NC_013739, from 1338329 to 1338382 (54 bp); Conexibacter woesei DSM 14684 GCCGCCCGTCCCGCCCGTCCCGCCCGCGCCGCCCGTCCCGCCCGTCCCGCCCGC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1338141-1338665	Sequence	Cwoe_1273 - hypothetical protein (Protein is coded in complementary strand; from 1338665 to 1338141)