Sequence retrieval

Genome: Conexibacter woesei DSM 14684
Start position: 1372180
End position: 1372203
Length: 24

DNA sequence
>NC_013739, from 1372180 to 1372203 (24 bp); Conexibacter woesei DSM 14684 GCGCCGGTGCCGTCGCCGGTGCCG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1371994-1373247	Sequence	Cwoe_1301 - beta-lactamase (Protein is coded in complementary strand; from 1373247 to 1371994)