Sequence retrieval

Genome: Conexibacter woesei DSM 14684
Start position: 1375293
End position: 1375316
Length: 24

DNA sequence
>NC_013739, from 1375293 to 1375316 (24 bp); Conexibacter woesei DSM 14684 GCGCCGGCGTCGGCACCGGCGGCG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1375283-1377997	Sequence	Cwoe_1304 - CoA-binding protein (Protein is coded in complementary strand; from 1377997 to 1375283)