Sequence retrieval

Genome: Conexibacter woesei DSM 14684
Start position: 151027
End position: 151050
Length: 24

DNA sequence
>NC_013739, from 151027 to 151050 (24 bp); Conexibacter woesei DSM 14684 AGCGGCGGCGGCAGCAGCAGCGAC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 150988-151911	Sequence	Cwoe_0153 - NAD(+) diphosphatase (Protein is coded in complementary strand; from 151911 to 150988)