Sequence retrieval

Genome: Conexibacter woesei DSM 14684
Start position: 1578591
End position: 1578626
Length: 36

DNA sequence
>NC_013739, from 1578591 to 1578626 (36 bp); Conexibacter woesei DSM 14684 CGCCGCTCCCGCCGCTCCCGCCACTCCCGCCGCTCG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1576901-1580647	Sequence	Cwoe_1491 - nitrate reductase subunit alpha (Protein is coded in complementary strand; from 1580647 to 1576901)