Sequence retrieval

Genome: Conexibacter woesei DSM 14684
Start position: 1582722
End position: 1582745
Length: 24

DNA sequence
>NC_013739, from 1582722 to 1582745 (24 bp); Conexibacter woesei DSM 14684 GGCGCGGCCGCGGGCGCAGGCGCG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1582566-1582895	Sequence	Cwoe_1495 - hypothetical protein (Protein is coded in complementary strand; from 1582895 to 1582566)