Sequence retrieval

Genome: Conexibacter woesei DSM 14684
Start position: 1620704
End position: 1620739
Length: 36

DNA sequence
>NC_013739, from 1620704 to 1620739 (36 bp); Conexibacter woesei DSM 14684 GCGCCGTCGCCGGAGCCGGCGCCTGCGTCGTCGCCG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1619789-1620829	Sequence	Cwoe_1532 - periplasmic solute binding protein (Protein is coded in complementary strand; from 1620829 to 1619789)