Sequence retrieval

Genome: Conexibacter woesei DSM 14684
Start position: 1638875
End position: 1638910
Length: 36

DNA sequence
>NC_013739, from 1638875 to 1638910 (36 bp); Conexibacter woesei DSM 14684 AGCGCGGCGCGCAGCGCGGTCCGCAGCGCGGCACGG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1638779-1639912	Sequence	Cwoe_1550 - UDP-N-acetylglucosamine:LPS N-acetylglucosamine transferase-like protein (Protein is coded in complementary strand; from 1639912 to 1638779)