Sequence retrieval

Genome: Conexibacter woesei DSM 14684
Start position: 1664163
End position: 1664187
Length: 25

DNA sequence
>NC_013739, from 1664163 to 1664187 (25 bp); Conexibacter woesei DSM 14684 CGCCGCGCCGCGCAGCGCGGCGTCG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1663366-1664331	Sequence	Cwoe_1574 - Urea carboxylase (Protein is coded in complementary strand; from 1664331 to 1663366)