Sequence retrieval

Genome: Conexibacter woesei DSM 14684
Start position: 1684035
End position: 1684085
Length: 51

DNA sequence
>NC_013739, from 1684035 to 1684085 (51 bp); Conexibacter woesei DSM 14684 GCGTGGCTCAGCCCGCGGCGCGGCTCAACCAGCGGCGCGGCTCAGCCCGCG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF... 1684077-1684601	Sequence	Cwoe_1597 - TetR family transcriptional regulator (Protein is coded in complementary strand; from 1684601 to 1684077)