Sequence retrieval

Genome: Conexibacter woesei DSM 14684
Start position: 1688978
End position: 1689002
Length: 25

DNA sequence
>NC_013739, from 1688978 to 1689002 (25 bp); Conexibacter woesei DSM 14684 GCGCGCCGCGGAGCGGCTCGGCGTG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1688885-1689121	Sequence	Cwoe_1606 - hypothetical protein (Protein is coded in complementary strand; from 1689121 to 1688885)