Sequence retrieval

Genome: Conexibacter woesei DSM 14684
Start position: 1751278
End position: 1751304
Length: 27

DNA sequence
>NC_013739, from 1751278 to 1751304 (27 bp); Conexibacter woesei DSM 14684 CCGCGCCGCCCGCGCAGCCAGCGCCGC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1750582-1751337	Sequence	Cwoe_1665 - hypothetical protein (Protein is coded in complementary strand; from 1751337 to 1750582)