Sequence retrieval

Genome: Conexibacter woesei DSM 14684
Start position: 1752691
End position: 1752714
Length: 24

DNA sequence
>NC_013739, from 1752691 to 1752714 (24 bp); Conexibacter woesei DSM 14684 GCCTCTGTCTCTGTCTCTGTCTCT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1751606-1754326	Sequence	Cwoe_1666 - lytic transglycosylase (Protein is coded in complementary strand; from 1754326 to 1751606)