Sequence retrieval

Genome: Conexibacter woesei DSM 14684
Start position: 1879708
End position: 1879761
Length: 54

DNA sequence
>NC_013739, from 1879708 to 1879761 (54 bp); Conexibacter woesei DSM 14684 GGCTCCGGCGCTGCGGCGGGCTCCGGCGCTGCGGCGGGCTCCGGCGCGGCGCTG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1879405-1880172	Sequence	Cwoe_1786 - hypothetical protein (Protein is coded in complementary strand; from 1880172 to 1879405)