Sequence retrieval

Genome: Conexibacter woesei DSM 14684
Start position: 1960093
End position: 1960152
Length: 60

DNA sequence
>NC_013739, from 1960093 to 1960152 (60 bp); Conexibacter woesei DSM 14684 GTCGCCGCTCCAGGCGTCGCCGCTCCCGGCGTGGCCGCCCCCGGCGTGGCCGCCCCCGGC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1959910-1960485	Sequence	Cwoe_1861 - hypothetical protein (Protein is coded in complementary strand; from 1960485 to 1959910)