Sequence retrieval

Genome: Conexibacter woesei DSM 14684
Start position: 2016448
End position: 2016471
Length: 24

DNA sequence
>NC_013739, from 2016448 to 2016471 (24 bp); Conexibacter woesei DSM 14684 GATCGCGACCGCGATCCCGACCGC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2015984-2016823	Sequence	Cwoe_1921 - hypothetical protein (Protein is coded in complementary strand; from 2016823 to 2015984)