Sequence retrieval

Genome: Conexibacter woesei DSM 14684
Start position: 2020910
End position: 2020969
Length: 60

DNA sequence
>NC_013739, from 2020910 to 2020969 (60 bp); Conexibacter woesei DSM 14684 ACCGCCCGGCTCCCTGCTGCCCGGCTCTCTGCCGCCGGGCTCTCTGCCGCCGGGCTCTCT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2020443-2023532	Sequence	Cwoe_1924 - FG-GAP repeat-containing protein (Protein is coded in complementary strand; from 2023532 to 2020443)