Sequence retrieval

Genome: Conexibacter woesei DSM 14684
Start position: 2098112
End position: 2098135
Length: 24

DNA sequence
>NC_013739, from 2098112 to 2098135 (24 bp); Conexibacter woesei DSM 14684 CGTCGCCGACGCCGACGCCGACGC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2097445-2100069	Sequence	Cwoe_1997 - hypothetical protein (Protein is coded in complementary strand; from 2100069 to 2097445)