Sequence retrieval

Genome: Conexibacter woesei DSM 14684
Start position: 213429
End position: 213452
Length: 24

DNA sequence
>NC_013739, from 213429 to 213452 (24 bp); Conexibacter woesei DSM 14684 CGCGGCCGCGACCGCGGGCGGGGC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 213415-214797	Sequence	Cwoe_0210 - TrkA-N domain-containing protein (Protein is coded in complementary strand; from 214797 to 213415)