Sequence retrieval

Genome: Conexibacter woesei DSM 14684
Start position: 21527
End position: 21550
Length: 24

DNA sequence
>NC_013739, from 21527 to 21550 (24 bp); Conexibacter woesei DSM 14684 CGCCGTCGCCGGCGTCGTCGCCGC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 20542-22518	Sequence	Cwoe_0017 - serine/threonine protein kinase with PASTA sensor(s)