Sequence retrieval

Genome: Conexibacter woesei DSM 14684
Start position: 2157488
End position: 2157517
Length: 30

DNA sequence
>NC_013739, from 2157488 to 2157517 (30 bp); Conexibacter woesei DSM 14684 CGTGATCGCGATCCTGATCGCGATCGCGAT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2157244-2159178	Sequence	Cwoe_2053 - oligopeptide/dipeptide ABC transporter ATPase