Sequence retrieval

Genome: Conexibacter woesei DSM 14684
Start position: 2171978
End position: 2172001
Length: 24

DNA sequence
>NC_013739, from 2171978 to 2172001 (24 bp); Conexibacter woesei DSM 14684 GACGCCGGCGCCGACGACGACGAC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2170656-2172032	Sequence	Cwoe_2065 - amine oxidase (Protein is coded in complementary strand; from 2172032 to 2170656)