Sequence retrieval

Genome: Conexibacter woesei DSM 14684
Start position: 229312
End position: 229347
Length: 36

DNA sequence
>NC_013739, from 229312 to 229347 (36 bp); Conexibacter woesei DSM 14684 CCGCCGGTCCCGCCGGTCCCGCCGGTCCCGCCGGTC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 228343-230160	Sequence	Cwoe_0225 - peptidoglycan-binding protein (Protein is coded in complementary strand; from 230160 to 228343)