Sequence retrieval

Genome: Conexibacter woesei DSM 14684
Start position: 2300263
End position: 2300286
Length: 24

DNA sequence
>NC_013739, from 2300263 to 2300286 (24 bp); Conexibacter woesei DSM 14684 GCGACGGCGTCGGCGTCGGCGGCG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2300137-2301441	Sequence	Cwoe_2189 - phenylacetate-CoA ligase (Protein is coded in complementary strand; from 2301441 to 2300137)