Sequence retrieval

Genome: Conexibacter woesei DSM 14684
Start position: 2368778
End position: 2368807
Length: 30

DNA sequence
>NC_013739, from 2368778 to 2368807 (30 bp); Conexibacter woesei DSM 14684 CGCCGGCTCCGGCGCCGCCGCGGGCGCCGG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2368190-2369905	Sequence	Cwoe_2248 - thiamine pyrophosphate TPP binding domain-containing protein