Sequence retrieval

Genome: Conexibacter woesei DSM 14684
Start position: 2400505
End position: 2400528
Length: 24

DNA sequence
>NC_013739, from 2400505 to 2400528 (24 bp); Conexibacter woesei DSM 14684 GGCACGGCCACGCGCACGGGCTCG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2400490-2401188	Sequence	Cwoe_2282 - hypothetical protein (Protein is coded in complementary strand; from 2401188 to 2400490)