Sequence retrieval

Genome: Conexibacter woesei DSM 14684
Start position: 2403357
End position: 2403392
Length: 36

DNA sequence
>NC_013739, from 2403357 to 2403392 (36 bp); Conexibacter woesei DSM 14684 CCTCGCCCGCCTCGCCCGCCTCGCCCGCCTCGCCCG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2402465-2403664	Sequence	Cwoe_2284 - dyp-type peroxidase family protein (Protein is coded in complementary strand; from 2403664 to 2402465)