Sequence retrieval

Genome: Conexibacter woesei DSM 14684
Start position: 2408944
End position: 2408967
Length: 24

DNA sequence
>NC_013739, from 2408944 to 2408967 (24 bp); Conexibacter woesei DSM 14684 GCGGCGTCGGCGGCGTCGGCGCCG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2408806-2412240	Sequence	Cwoe_2289 - methylmalonyl-CoA mutase (Protein is coded in complementary strand; from 2412240 to 2408806)