Sequence retrieval

Genome: Conexibacter woesei DSM 14684
Start position: 2464480
End position: 2464515
Length: 36

DNA sequence
>NC_013739, from 2464480 to 2464515 (36 bp); Conexibacter woesei DSM 14684 CGGCGACGCCGGCCGCGACGGCGGCGGCGCTGCCGG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2463537-2465108	Sequence	Cwoe_2328 - amidase (Protein is coded in complementary strand; from 2465108 to 2463537)