Sequence retrieval

Genome: Conexibacter woesei DSM 14684
Start position: 2528490
End position: 2528513
Length: 24

DNA sequence
>NC_013739, from 2528490 to 2528513 (24 bp); Conexibacter woesei DSM 14684 CGTCGCCGTCGAGGTCGCCGGCGC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2527316-2529289	Sequence	Cwoe_2386 - FG-GAP repeat-containing protein (Protein is coded in complementary strand; from 2529289 to 2527316)