Sequence retrieval

Genome: Conexibacter woesei DSM 14684
Start position: 2555796
End position: 2555858
Length: 63

DNA sequence
>NC_013739, from 2555796 to 2555858 (63 bp); Conexibacter woesei DSM 14684 CCGCGGCGGCCGGCGGCAGCGGCGCGGCGGCGGACGGCGGCGCGGCGGCGGCGGCCGGCGGCG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2553284-2556643	Sequence	Cwoe_2409 - transcriptional activator domain-containing protein (Protein is coded in complementary strand; from 2556643 to 2553284)