Sequence retrieval

Genome: Conexibacter woesei DSM 14684
Start position: 2587458
End position: 2587520
Length: 63

DNA sequence
>NC_013739, from 2587458 to 2587520 (63 bp); Conexibacter woesei DSM 14684 CCGGCGGCGGGAGCGCCGGCGGGGTCGGCGGGAGCGCCGGCGGGGTCGGCGGGAGCGTCGGCG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2587092-2588180	Sequence	Cwoe_2438 - AraC family transcriptional regulator (Protein is coded in complementary strand; from 2588180 to 2587092)