Sequence retrieval

Genome: Conexibacter woesei DSM 14684
Start position: 2590586
End position: 2590610
Length: 25

DNA sequence
>NC_013739, from 2590586 to 2590610 (25 bp); Conexibacter woesei DSM 14684 GCCGCGCCGATCCGCGCCTCGACGC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2590181-2590837	Sequence	Cwoe_2442 - TetR family transcriptional regulator (Protein is coded in complementary strand; from 2590837 to 2590181)