Sequence retrieval

Genome: Conexibacter woesei DSM 14684
Start position: 2654435
End position: 2654488
Length: 54

DNA sequence
>NC_013739, from 2654435 to 2654488 (54 bp); Conexibacter woesei DSM 14684 CCGCGTCGCTCGCGCCGGCCGCGTCGCTCGCGCCGGCCGCGTCGCTCGCGCCGG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2653627-2654502	Sequence	Cwoe_2494 - short-chain dehydrogenase/reductase SDR (Protein is coded in complementary strand; from 2654502 to 2653627)