Sequence retrieval

Genome: Conexibacter woesei DSM 14684
Start position: 2701133
End position: 2701156
Length: 24

DNA sequence
>NC_013739, from 2701133 to 2701156 (24 bp); Conexibacter woesei DSM 14684 GCGGCGACGGCGGCGCCGGCGGCG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2701085-2701744	Sequence	Cwoe_2535 - GntR family transcriptional regulator (Protein is coded in complementary strand; from 2701744 to 2701085)