Sequence retrieval

Genome: Conexibacter woesei DSM 14684
Start position: 2970069
End position: 2970092
Length: 24

DNA sequence
>NC_013739, from 2970069 to 2970092 (24 bp); Conexibacter woesei DSM 14684 GCTCGCCCTCGCGATCGCGCTGGC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2969762-2970718	Sequence	Cwoe_2782 - binding-protein-dependent transporters inner membrane component