Sequence retrieval

Genome: Conexibacter woesei DSM 14684
Start position: 2985460
End position: 2985483
Length: 24

DNA sequence
>NC_013739, from 2985460 to 2985483 (24 bp); Conexibacter woesei DSM 14684 GGCGCTGGCGCTGACGCTCGCGCT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2985174-2986037	Sequence	Cwoe_2799 - binding-protein-dependent transporters inner membrane component