Sequence retrieval

Genome: Conexibacter woesei DSM 14684
Start position: 2992208
End position: 2992232
Length: 25

DNA sequence
>NC_013739, from 2992208 to 2992232 (25 bp); Conexibacter woesei DSM 14684 CGCGCAGCGCCGCGACGAGCCGCTC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2991880-2993364	Sequence	Cwoe_2805 - Orn/Lys/Arg decarboxylase major region (Protein is coded in complementary strand; from 2993364 to 2991880)