Sequence retrieval

Genome: Conexibacter woesei DSM 14684
Start position: 3021123
End position: 3021149
Length: 27

DNA sequence
>NC_013739, from 3021123 to 3021149 (27 bp); Conexibacter woesei DSM 14684 CGGGTCGCGCGGGGCGCGCGCGTCGCG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 3021055-3021789	Sequence	Cwoe_2828 - hypothetical protein (Protein is coded in complementary strand; from 3021789 to 3021055)