Sequence retrieval

Genome: Conexibacter woesei DSM 14684
Start position: 3067898
End position: 3067951
Length: 54

DNA sequence
>NC_013739, from 3067898 to 3067951 (54 bp); Conexibacter woesei DSM 14684 GAGCCGGAGGCTGCCGCTGAGCCGGAGGCTGCCGCTGAGCCGGAGGCTGCCGCT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 3066462-3068051	Sequence	Cwoe_2872 - RNA binding S1 domain-containing protein