Sequence retrieval

Genome: Conexibacter woesei DSM 14684
Start position: 3088190
End position: 3088216
Length: 27

DNA sequence
>NC_013739, from 3088190 to 3088216 (27 bp); Conexibacter woesei DSM 14684 ATCGTGCGGATCATGCGGATCGTGAGG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF.. 3087824-3088204	Sequence	Cwoe_2890 - aspartate 1-decarboxylase (Protein is coded in complementary strand; from 3088204 to 3087824)
ORF... 3088201-3089073	Sequence	Cwoe_2891 - pantoate/beta-alanine ligase (Protein is coded in complementary strand; from 3089073 to 3088201)